SubtiBank SubtiBank
yokU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yokU

unknown
locus
BSU_19689
pI
4.00
mw
11.00 kDa
protein length
gene length
279 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,139,179 2,139,457

    Expression and Regulation

    Operons

    genes
    [gene|13DC4296015A28975BC7697F134FB6ECD6B11489|yodT]-[gene|D8A050BF150C6E5B910C24C0E023F0829EC95BAD|yodS]-[gene|138832210AC94B17E081F3D0AF9BCFE3BE63E601|yodR]-[gene|161ADC907D4902001C8751F51CFA762828C26110|yodQ]-[gene|39749B5EADC3C056BAF232E0B586C65B989F7F77|yodP]-[gene|21589FEBDE54C66DE2A3DCFC2D7BF3AEEC84B44C|kamA]-[gene|A4A099EE3368891C2AD6C2D1DCBE7B238227417F|yokU]-[gene|0A33869E05CC9B49699555EA19D0905A55CA35B9|yozE]
    description
    [Pubmed|22383849,14523133]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|14523133], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporuation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|14523133]
  • view in new tab

    Biological materials

    Mutant

  • BKE19689 ([gene|A4A099EE3368891C2AD6C2D1DCBE7B238227417F|yokU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19689 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGAAGAATCCCCTCC, downstream forward: _UP4_TGAGTCATGTTTCAGTATTC
  • BKK19689 ([gene|A4A099EE3368891C2AD6C2D1DCBE7B238227417F|yokU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19689 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGAAGAATCCCCTCC, downstream forward: _UP4_TGAGTCATGTTTCAGTATTC
  • References

  • 14523133,27766092