SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


11.00 kDa
protein length
gene length
279 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    2,139,179 2,139,457

    Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|14523133], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporuation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|14523133]
  • view in new tab

    Biological materials


  • BKE19689 ([gene|A4A099EE3368891C2AD6C2D1DCBE7B238227417F|yokU]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGAAGAATCCCCTCC, downstream forward: _UP4_TGAGTCATGTTTCAGTATTC
  • BKK19689 ([gene|A4A099EE3368891C2AD6C2D1DCBE7B238227417F|yokU]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGAAGAATCCCCTCC, downstream forward: _UP4_TGAGTCATGTTTCAGTATTC
  • References

  • 14523133,27766092