SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


antilisterial bacteriocin (subtilosin) production
43.20 kDa
protein length
386 aa Sequence Blast
gene length
1161 bp Sequence Blast
antilisterial bacteriocin (subtilosin) production
processing protease

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    3,839,852 3,841,012

    Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10572140], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10809710], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|10572140,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [Pubmed|10809710]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials


  • MGNA-A527 (ywhO::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37410 ([gene|A474F01AA4AD859963E39CD528BC42FF43A72433|albE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGAAAATTGATGAGTCTTCA, downstream forward: _UP4_GCTCATGTAGTAAGGGGATG
  • BKK37410 ([gene|A474F01AA4AD859963E39CD528BC42FF43A72433|albE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGAAAATTGATGAGTCTTCA, downstream forward: _UP4_GCTCATGTAGTAAGGGGATG
  • References

  • 10809709,10572140,15743949,10809710,10572140,17720793