SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


sporulation-specific protease
33.17 kDa
protein length
290 aa Sequence Blast
gene length
873 bp Sequence Blast
modification of spore coat proteins

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Not yet assigned]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    51,680 52,552

    The protein

    Catalyzed reaction/ biological activity

  • temperature-dependent modification of the coat proteins such as [protein|1CA990DA55B6F879968C431A703E0478F5564A1A|GerQ] (together with [protein|4A2B1DA38608E5A4096087BF7246D4C64C54DBE3|Tgl]) [Pubmed|16751597]
  • cleaves the spore coat proteins [protein|A25C1530DA7BB007A288E525404E9F775E219FE8|SpoIVA] and [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [pubmed|11040425]
  • Protein family

  • Peptidase U57 family (together with [protein|8EDB1BCEEE64FDAF1C9054300751FCB420658865|YabR]) (according to UniProt)
  • [SW|Localization]

  • forespore outer membrane (according to Swiss-Prot), spore coat [Pubmed|19060142]
  • Additional information

  • colocalizes in the spore coat with [protein|D2A0A4793350632217F4425EB6F459B538067CD7|YeeK] [Pubmed|19060142]
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,10714992], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,10714992]
  • view in new tab

    Biological materials


  • MGNA-B908 (yabG::erm), available at the [ NBRP B. subtilis, Japan]
  • 1S128 ( ''yabG''::''erm''), [Pubmed|16751597], available at [ BGSC]
  • 1S128 ( ''yabG''::''erm''), [Pubmed|16751597], available at [ BGSC]
  • 1A814 ( ''yabG''::''spec''), [Pubmed|11267663], available at [ BGSC]
  • BKE00430 ([gene|A46D07F8F56249A04C5F880120D19F00C9CAE112|yabG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTCCTCACTCCACACA, downstream forward: _UP4_TAACAGTTGAAAACCTGCAT
  • BKK00430 ([gene|A46D07F8F56249A04C5F880120D19F00C9CAE112|yabG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTCCTCACTCCACACA, downstream forward: _UP4_TAACAGTTGAAAACCTGCAT
  • References


  • 19797877
  • Original Publications

  • 10714992,19060142,16751597,15699190,11040425