SubtiBank SubtiBank
yabG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yabG

sporulation-specific protease
locus
BSU_00430
pI
9.14
mw
33.17 kDa
protein length
290 aa Sequence Blast
gene length
873 bp Sequence Blast
function
modification of spore coat proteins
product
protease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    51,680 52,552

    The protein

    Catalyzed reaction/ biological activity

  • temperature-dependent modification of the coat proteins such as [protein|1CA990DA55B6F879968C431A703E0478F5564A1A|GerQ] (together with [protein|4A2B1DA38608E5A4096087BF7246D4C64C54DBE3|Tgl]) [Pubmed|16751597]
  • cleaves the spore coat proteins [protein|A25C1530DA7BB007A288E525404E9F775E219FE8|SpoIVA] and [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [pubmed|11040425]
  • Protein family

  • Peptidase U57 family (together with [protein|8EDB1BCEEE64FDAF1C9054300751FCB420658865|YabR]) (according to UniProt)
  • [SW|Localization]

  • forespore outer membrane (according to Swiss-Prot), spore coat [Pubmed|19060142]
  • Additional information

  • colocalizes in the spore coat with [protein|D2A0A4793350632217F4425EB6F459B538067CD7|YeeK] [Pubmed|19060142]
  • Expression and Regulation

    Operons

    genes
    [gene|A46D07F8F56249A04C5F880120D19F00C9CAE112|yabG]
    description
    [Pubmed|10714992]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,10714992], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,10714992]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B908 (yabG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1907 NBRP B. subtilis, Japan]
  • 1S128 ( ''yabG''::''erm''), [Pubmed|16751597], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S128&Search=1S128 BGSC]
  • 1S128 ( ''yabG''::''erm''), [Pubmed|16751597], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S128&Search=1S128 BGSC]
  • 1A814 ( ''yabG''::''spec''), [Pubmed|11267663], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A814&Search=1A814 BGSC]
  • BKE00430 ([gene|A46D07F8F56249A04C5F880120D19F00C9CAE112|yabG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTCCTCACTCCACACA, downstream forward: _UP4_TAACAGTTGAAAACCTGCAT
  • BKK00430 ([gene|A46D07F8F56249A04C5F880120D19F00C9CAE112|yabG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTCCTCACTCCACACA, downstream forward: _UP4_TAACAGTTGAAAACCTGCAT
  • References

    Reviews

  • 19797877
  • Original Publications

  • 10714992,19060142,16751597,15699190,11040425