SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


two-component response regulator ([SW|OmpR family]), control of cellular responses to [SW|protein secretion] stress
26.06 kDa
protein length
225 aa Sequence Blast
gene length
678 bp Sequence Blast
control of cellular responses to protein secretion stress
two-component response regulator ([SW|OmpR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    3,385,724 3,386,401

    The protein

    Protein family

  • [SW|OmpR family] of two-component response regulators
  • [SW|Domains]

  • [SW|Response regulatory domain] (aa 4-117) (according to UniProt)
  • Modification

  • phosphorylated by [protein|4EE48E4931F662E51586DB6D01E91C688329222D|CssS] on an Asp residue
  • Effectors of protein activity

  • phosphorylation likely affects DNA-binding activity
  • Structure

  • [PDB|2OQR] (from Mycobacterium tuberculosis, 34% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • [protein|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR] may interact with [SW|RNA polymerase] [pubmed|21710567]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12270824], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR]: activation, [Pubmed|12270824], in [regulon|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR regulon]
  • regulation

  • expressed under conditions of secretion stress ([protein|search|CssR]) [Pubmed|12270824]
  • view in new tab

    Biological materials


  • MGNA-B031 (yvqA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33010 ([gene|A40CD2C23A19860342F440284302EFFDAC09E88A|cssR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGCTCTTCACATCCTTT, downstream forward: _UP4_TTCGGCTACAGGATGATGTC
  • BKK33010 ([gene|A40CD2C23A19860342F440284302EFFDAC09E88A|cssR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGCTCTTCACATCCTTT, downstream forward: _UP4_TTCGGCTACAGGATGATGTC
  • References


  • 27518094
  • Original Publications

  • 10094672,17600057,21710567,17088376,12270824,12270824,11555295,19820159,21602801,21624103,21710567