SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative membrane-bound acyltransferase
40.88 kDa
protein length
362 aa Sequence Blast
gene length
1089 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    910,840 911,928

    The protein

    Protein family

  • Acyltransferase 3 family (with [protein|E97C7A219DB059BB634E893CC355A28324C87ADB|OatA] and [protein|07A53089107037359C428549FF877638B90CF074|YkrP], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C305 (yfiQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08360 ([gene|A408883503931320B1BC04F38E6D475530518A25|yfiQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAGCGCTCCTTTTAT, downstream forward: _UP4_TGAAAAACAAGCGGCAGGAG
  • BKK08360 ([gene|A408883503931320B1BC04F38E6D475530518A25|yfiQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAGCGCTCCTTTTAT, downstream forward: _UP4_TGAAAAACAAGCGGCAGGAG