SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


tRNA uridine hydroxylase (in complex with [protein|D4046AA4C4ACB6A0A2F2020CA1E659F65CAFE68D|YrrO])
34.92 kDa
protein length
309 aa Sequence Blast
gene length
930 bp Sequence Blast
introduction of 5-methoxyuridine modification in tRNA (U34)
tRNA uridine hydroxylase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • Gene

    2,794,147 2,795,076

    Phenotypes of a mutant

  • 50% reduction in mo5U tRNA levels [pubmed|31358606]
  • The protein

    Catalyzed reaction/ biological activity

  • hydroxylation of U34 in tRNA to give 5-hydroxyuridine (ho5U) (in complex with [protein|D4046AA4C4ACB6A0A2F2020CA1E659F65CAFE68D|YrrO]) with prephenate as hydroxyl donor, ho5U is the precursor for 5-methoxyuridine modification (by [protein|CE4F2965077F2A5882432D683520E09B70B9369A|TrmR]) [pubmed|31358606]
  • Protein family

  • peptidase U32 family (with [protein|D4046AA4C4ACB6A0A2F2020CA1E659F65CAFE68D|YrrO], according to UniProt)
  • Paralogous protein(s)

  • [protein|D4046AA4C4ACB6A0A2F2020CA1E659F65CAFE68D|YrrO]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A008 (yrrN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27350 ([gene|A3EC327DA14F188E88AF4221B51EE5950F882277|yrrN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACGTTCACCTCTTCTT, downstream forward: _UP4_TATTAATCAAAAGGAGGTTA
  • BKK27350 ([gene|A3EC327DA14F188E88AF4221B51EE5950F882277|yrrN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACGTTCACCTCTTCTT, downstream forward: _UP4_TATTAATCAAAAGGAGGTTA
  • References

    Research papers

  • 31358606