SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


50.36 kDa
protein length
462 aa Sequence Blast
gene length
1389 bp Sequence Blast
TCA cycle
fumarate hydratase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|TCA cycle]
  • Gene

    3,389,024 3,390,412

    The protein

    Catalyzed reaction/ biological activity

  • (S)-malate --> fumarate + H2O (according to UniProt)
  • Protein family

  • class-II fumarase/aspartase family (with [protein|5FAE80F22AEBAE63FC3C872EC651166A65C34DC2|AnsB], according to UniProt)
  • Paralogous protein(s)

  • [protein|5FAE80F22AEBAE63FC3C872EC651166A65C34DC2|AnsB]
  • Structure

  • [PDB|1FUO] (from ''E. coli'', 64% identity) [Pubmed|8909293]
  • [SW|Localization]

  • forms discrete foci in the cytoplasm [pubmed|29140245]
  • colocalizes with DNA upon DNA damage (MMS treatment) [pubmed|29140245]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3130545,2509422,2509423], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|3130545,2509422], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulation

  • constitutive
  • view in new tab

    view in new tab

    additional information

  • the protein amounts increase upon DNA damage (MMS treatment) [pubmed|29140245]
  • Biological materials


  • GP718 (spec), available in [SW|Jörg Stülke]'s lab [pubmed|20933603]
  • GP2340 Δ''[gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]''::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • GP2341 Δ''[gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]''::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • BKE33040 ([gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATGTATCCCTCCATA, downstream forward: _UP4_TAATAGGAAGAACGGCTGCT
  • BKK33040 ([gene|A3A2EF3C95B833A11843553107D781EDEFF0BC41|citG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATGTATCCCTCCATA, downstream forward: _UP4_TAATAGGAAGAACGGCTGCT
  • Expression vectors

  • pGP1122 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP380]) (available in [SW|Jörg Stülke]'s lab) [pubmed|20933603]
  • lacZ fusion

  • pGP387 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP1433 (spc, based on [SW|pGP1870]), available in the [SW|Jörg Stülke] lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1132 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • **
  • References

  • 2509422,3923430,3130545,2509423,20933603,15378759,6098632,8909293,29140245