SubtiBank SubtiBank
mpr
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mpr

extracellular metalloprotease
locus
BSU_02240
pI
8.97
mw
33.69 kDa
protein length
313 aa Sequence Blast
gene length
942 bp Sequence Blast
function
protein degradation
product
extracellular metalloprotease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.5|Utilization of proteins]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.2|Extracellular feeding proteases]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    245,190 246,131

    The protein

    Protein family

  • peptidase S1B family (single member, according to UniProt)
  • Structure

  • [PDB|1P3C] (from B. intermedius, corresponds to aa 95 ... 289, 31% identity) [pubmed|15005613]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|A39D349BBE13F4F3F6D33DA72CB8149A5170255C|mpr]-[gene|22A5905A0C2A9303C166A5C2D784AF0B6541A311|ybfJ]
    description
    [Pubmed|12107147]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|25666135], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • view in new tab

    Biological materials

    Mutant

  • KO7 (''nprE aprE epr mpr nprB vpr bpr''), available as BGSC 1A1133
  • BKE02240 ([gene|A39D349BBE13F4F3F6D33DA72CB8149A5170255C|mpr]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTCATCTCCCTCCT, downstream forward: _UP4_AACTTGGGAACAAGGGTGAC
  • BKK02240 ([gene|A39D349BBE13F4F3F6D33DA72CB8149A5170255C|mpr]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTCATCTCCCTCCT, downstream forward: _UP4_AACTTGGGAACAAGGGTGAC
  • References

    Reviews

  • 20735481
  • Original publications

  • 15375126,24115457,18957862,12107147,25666135,15005613