SubtiBank SubtiBank
yfkI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfkI

general stress protein, required for protection against paraquat stress
locus
BSU07890
pI
10.35
mw
11.91 kDa
protein length
106 aa Sequence Blast
gene length
321 bp Sequence Blast
function
protection against paraquat stress
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    862,492 862,812

    Expression and Regulation

    Operons

    genes
    [gene|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|yfkJ]-[gene|A38D85EE1BCCA5E5E77CAF9583E7D052BB7F8188|yfkI]-[gene|0A9352AB10C7DC06BF477EBE384D6E21D920AAC8|yfkH]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11532142], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528,11532142], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528,11532142]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C267 (yfkI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2265 NBRP B. subtilis, Japan]
  • BKE07890 ([gene|A38D85EE1BCCA5E5E77CAF9583E7D052BB7F8188|yfkI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCATGCAAATTCTCCTTT, downstream forward: _UP4_TGATCAAACATGCGAGGTGA
  • BKK07890 ([gene|A38D85EE1BCCA5E5E77CAF9583E7D052BB7F8188|yfkI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCATGCAAATTCTCCTTT, downstream forward: _UP4_TGATCAAACATGCGAGGTGA
  • References

  • 15805528,11532142,22582280