SubtiBank SubtiBank
ywgB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywgB

similar to transcription factor
locus
BSU_37580
pI
5.64
mw
17.29 kDa
protein length
156 aa Sequence Blast
gene length
471 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,858,417 3,858,887

    The protein

    [SW|Domains]

  • [SW|HTH rrf2-type domain] (aa 2-133) (according to UniProt)
  • Structure

  • [PDB|6HSD] (from Streptomyces venezuelae, corresponds to aa 1 ... 90, 42% identity) [pubmed|30657661]
  • Biological materials

    Mutant

  • MGNA-A587 (ywgB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/587 NBRP B. subtilis, Japan]
  • BKE37580 ([gene|A350DE517F0D637DC5CCB0EADDAD301C889062E9|ywgB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTATTCACTCCTGATT, downstream forward: _UP4_AAGCAAGTGAAAGGGCAATT
  • BKK37580 ([gene|A350DE517F0D637DC5CCB0EADDAD301C889062E9|ywgB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTATTCACTCCTGATT, downstream forward: _UP4_AAGCAAGTGAAAGGGCAATT
  • References

    Research papers

  • 30657661