SubtiBank SubtiBank
ykzC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ykzC

unknown
locus
BSU_14680
pI
5.52
mw
16.15 kDa
protein length
142 aa Sequence Blast
gene length
429 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,538,264 1,538,692

    The protein

    [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 1-138) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|AD151804FC145854DB6BAA12CD52758FB1C3882F|yktC]-[gene|A313B197D6D885EEE7F739E1F137794A8E3AD8F9|ykzC]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B354 (ykzC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1353 NBRP B. subtilis, Japan]
  • BKE14680 ([gene|A313B197D6D885EEE7F739E1F137794A8E3AD8F9|ykzC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCTGAGATCATCCTGCT, downstream forward: _UP4_TGATAATGGCAGCTTATTTG
  • BKK14680 ([gene|A313B197D6D885EEE7F739E1F137794A8E3AD8F9|ykzC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCTGAGATCATCCTGCT, downstream forward: _UP4_TGATAATGGCAGCTTATTTG
  • References

  • 26577401