SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


13.27 kDa
protein length
114 aa Sequence Blast
gene length
345 bp Sequence Blast
purine utilization

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    3,334,646 3,334,990

    The protein

    Catalyzed reaction/ biological activity

  • 5-hydroxyisourate + H2O = 5-hydroxy-2-oxo-4-ureido-2,5-dihydro-1H-imidazole-5-carboxylate (according to Swiss-Prot)
  • Protein family

  • 5-hydroxyisourate hydrolase subfamily (according to Swiss-Prot)
  • Structure

  • [PDB|2H0E] [Pubmed|16782815]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029039], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab


    regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: auto-repression, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    Biological materials


  • MGNA-A938 (yunM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32460 ([gene|A2F93FFE225DFDBCBB3EA079BEF84C79465F0E5C|pucM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATATGGGTTGTCAGTTTTC, downstream forward: _UP4_TAAGAAGGAAGCCCGCCTCA
  • BKK32460 ([gene|A2F93FFE225DFDBCBB3EA079BEF84C79465F0E5C|pucM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATATGGGTTGTCAGTTTTC, downstream forward: _UP4_TAAGAAGGAAGCCCGCCTCA
  • References

  • 11344136,12823818,12029039,16782815,20168977,25755103