SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


diguanylate cyclase and potential phosphodiesterase
84.63 kDa
protein length
749 aa Sequence Blast
gene length
2250 bp Sequence Blast
synthesis of c-di-GMP
diguanylate cyclase and potential phosphodiesterase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,407,329 1,409,578

    The protein

    Catalyzed reaction/ biological activity

  • synthesis of c-di-GMP from two molecules of GTP [Pubmed|23893111]
  • [SW|Domains]

  • MHYT domain (aa 7-201) (according to UniProt)
  • contains a N-terminal [SW|PAS domain] [Pubmed|23893111]
  • contains a central [SW|GGDEF domain] and a C-terminal [SW|EAL domain] [Pubmed|22821967]
  • aa 290-735 are similar to ''E. coli'' CsrD (18% identity, 43% similarity)
  • Structure

  • [PDB|5XGB] (from Pseudomonas aeruginosa, corresponds to the C-terminal part of DgcW, aa 194 ... 735, 29% identity) [pubmed|29109186]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials


  • MGNA-B314 (ykoW::erm), available at the [ NBRP B. subtilis, Japan]
  • GP850 (''[gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]''::''cat''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • BP140 (''[gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]''::''ermC'') available in [SW|Fabian Commichau]'s lab
  • BP142 (''[gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]-[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]''::''kan'') available in [SW|Fabian Commichau]'s lab
  • BKE13420 ([gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGGAGATTCCCCCCGT, downstream forward: _UP4_TAACAGCGCCGGCTTTTTTT
  • BKK13420 ([gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGGAGATTCCCCCCGT, downstream forward: _UP4_TAACAGCGCCGGCTTTTTTT
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 11728710,16980588,22821967,22383849,23893111,26577401,29109186