SubtiBank SubtiBank
yuiA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yuiA

unknown
locus
BSU_32090
pI
8.08
mw
4.74 kDa
protein length
gene length
144 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yumA

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,299,718 3,299,861

    Expression and Regulation

    Operons

    genes
    [gene|A2D4A1ED11B731DEECA13E145F9E581CCF4AF14D|yuiA]-[gene|C82E250EDFA44BB63C2C465C546A87BF40B76CC4|yuiB]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • repressed by [protein|search|CodY] [Pubmed|12618455]
  • view in new tab

    Biological materials

    Mutant

  • BKE32090 ([gene|A2D4A1ED11B731DEECA13E145F9E581CCF4AF14D|yuiA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAATCATCACCCTTTT, downstream forward: _UP4_TGACTTTATTTCAGCCCCCG
  • BKK32090 ([gene|A2D4A1ED11B731DEECA13E145F9E581CCF4AF14D|yuiA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTAATCATCACCCTTTT, downstream forward: _UP4_TGACTTTATTTCAGCCCCCG
  • References

  • 12618455,25755103