SubtiBank SubtiBank
bofC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bofC

general stress protein, controls processing of pro-[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK] by [protein|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|SpoIVFB]
locus
BSU_27750
pI
5.75
mw
19.15 kDa
protein length
170 aa Sequence Blast
gene length
513 bp Sequence Blast
function
control of processing of pro-[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK] by [protein|8801B095C2CE36F3E0B9DBBF489FFB217087DC0A|SpoIVFB]
product
forespore regulator of the [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigma-K] checkpoint
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    2,836,909 2,837,421

    The protein

    Structure

  • [PDB|2BW2]
  • Expression and Regulation

    Operons

    genes
    [gene|12B260DBC4E29151364251837FD227593D0BF391|csbX]-[gene|A2C94BB9272407B305B90151F77835BB90414D0F|bofC]
    description
    [Pubmed|9099855]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190,9099855], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|9099855], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224,9099855], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigF], [protein|search|SigG]) [Pubmed|16497325,9099855]
  • view in new tab

    Biological materials

    Mutant

  • BKE27750 ([gene|A2C94BB9272407B305B90151F77835BB90414D0F|bofC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCTCTACACCTCTTTGC, downstream forward: _UP4_TAGCGTCCGCTGATTGAAGA
  • BKK27750 ([gene|A2C94BB9272407B305B90151F77835BB90414D0F|bofC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCTCTACACCTCTTTGC, downstream forward: _UP4_TAGCGTCCGCTGATTGAAGA
  • References

    Reviews

  • 31350897
  • Original Publications

  • 16497325,10931291,16049010,9025289,11544224,9099855