SubtiBank SubtiBank
yhbF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhbF

bactofilin, required for flagellar hook- and filament assembly
locus
BSU08960
pI
6.64
mw
24.95 kDa
protein length
235 aa Sequence Blast
gene length
708 bp Sequence Blast
function
assembly of the flagellar hook and filament
product
bactofilin
essential
no
synonyms
yzdB

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.2|Flagellar proteins]
  • Gene

    Coordinates
    972,099 972,806

    Phenotypes of a mutant

  • complete loss of swimming motility [Pubmed|26517549]
  • The protein

    Paralogous protein(s)

  • [protein|CC0B2F230BD9F0F05B1DAF5BB2C92A9E30CDB5B7|YhbE]
  • [SW|Localization]

  • discrete assemblies at the cell membrane [Pubmed|26517549]
  • assemblies are relatively static, and partially colocalize with flagellar basal bodies [Pubmed|26517549]
  • Expression and Regulation

    Operons

    genes
    [gene|FDA5363A4DB711CD799BEFF395D58072CD8FFC44|yhbD]-[gene|CC0B2F230BD9F0F05B1DAF5BB2C92A9E30CDB5B7|yhbE]-[gene|A283DF56E47D601004F660809AB7BD32C644D422|yhbF]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A733 (yhbF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/733 NBRP B. subtilis, Japan]
  • BKE08960 ([gene|A283DF56E47D601004F660809AB7BD32C644D422|yhbF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTGTCTCCATTACGATCC, downstream forward: _UP4_TAAAACATTGTTCTGTTATA
  • BKK08960 ([gene|A283DF56E47D601004F660809AB7BD32C644D422|yhbF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTGTCTCCATTACGATCC, downstream forward: _UP4_TAAAACATTGTTCTGTTATA
  • References

  • 8626065,22383849,26517549