SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


molybdopterin-guanine dinucleotide biosynthesis
19.00 kDa
protein length
173 aa Sequence Blast
gene length
522 bp Sequence Blast
nitrate respiration
molybdenum cofactor synthesis protein

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of molybdopterin]
  • Gene

    1,498,445 1,498,966

    The protein

    Protein family

  • MobB family (single member, according to UniProt)
  • Structure

  • [PDB|4OYH]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE14290 ([gene|A283C34375EDF495940E2F03C4FB6A9FE841FA1E|mobB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTTTCCCGCTGTTTTGAA, downstream forward: _UP4_CAGCTGAAGGGGGAATCTGC
  • BKK14290 ([gene|A283C34375EDF495940E2F03C4FB6A9FE841FA1E|mobB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTTTCCCGCTGTTTTGAA, downstream forward: _UP4_CAGCTGAAGGGGGAATCTGC
  • References


  • 23539623
  • Original publications

  • 22383849