SubtiBank SubtiBank
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.


"Carbon-flux regulating HPr", formerly known as "Catabolite repression HPr-like protein", control of flux through the harmful methylglyoxal pathway, minor cofactor of the CcpA transcription factor
9.19 kDa
protein length
gene length
255 bp Sequence Blast
control of carbon flux
carbon-flux regulating HPr

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of transcription factor (other than two-component system)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    3,569,292 → 3,569,549

    The protein

    Protein family

  • [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]] family
  • Paralogous protein(s)

  • [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]]
  • [SW|Domains]

  • [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]] domain (1–85)
  • Modification

  • phosphorylation on Ser46 by [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|HprK] [Pubmed|9237995,21992469,22092971]
  • Structure

  • [PDB|2AK7] (dimeric Crh-Ser46-P)
  • [PDB|1ZVV] ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]-Crh-DNA complex)
  • [PDB|2RLZ] (dimer)
  • [PDB|1MU4]
  • [ NCBI], dimer
  • [ NCBI], [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]-Crh-DNA complex
  • [ NCBI], dimeric phosphor-Crh
  • [ NCBI]
  • Additional information

  • Crh does not possess the phosphorylation site used for [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] phosphotransfer (His-15 in [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|PtsH]), it can only be phosphorylated on Ser-46
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16272399], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • constitutive expression at both protein and RNA levels [Pubmed|24097947,22383849]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yvcI]' and '[protein|search|trxB]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • GP860 (aphA3) [Pubmed|21992469], QB7097 (spc), available in [SW|Jörg Stülke]'s lab
  • BKE34740 (Δ[gene|A269774F2FDC94F93BA5F1360FFFE754B50383AD|crh]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGATCTCCCCTTTTCT, downstream forward: _UP4_GCTTACGTTCAAGAAGAAGT
  • BKK34740 (Δ[gene|A269774F2FDC94F93BA5F1360FFFE754B50383AD|crh]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGATCTCCCCTTTTCT, downstream forward: _UP4_GCTTACGTTCAAGAAGAAGT
  • Expression vector

  • pGP641 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • pGP734 (C-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP382]), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • see ''[gene|0C40455EB53D25363FC3EB0E84502A76520F5F91|yvcI]
  • two-hybrid system

  • ''[gene|A269774F2FDC94F93BA5F1360FFFE754B50383AD|crh]'', ''crh(Ser46Asp)'', ''crh(Ser46Ala)'' ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • Labs working on this gene/protein

  • [SW|Boris Görke], University of Göttingen, Germany
  • [ Homepage]
  • [SW|Anne Galinier], University of Marseille, France
  • [SW|Wolfgang Hillen], Erlangen University, Germany [ Homepage]
  • [SW|Richard Brennan], Houston, Texas, USA [ Homepage]
  • References

  • 12972249,9973552,9237995,16272399,15126459,10217795,17142398,16316990,12009882,10589728,12670692,11916384,11361076,11361074,18320329,18284240,16411239,21992469,22092971