SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


ATPase, spore coat morphogenetic protein, anchors the spore coat to the spore surface via [protein|BBDA32A4EE3389D6F4404F7B3DA9E13AC7BF8055|SpoVM]
55.01 kDa
protein length
492 aa Sequence Blast
gene length
1479 bp Sequence Blast
initiation of spore coat assembly
ATPase, basement layer protein for spore coat assembly

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Class I]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,386,195 2,387,673

    Phenotypes of a mutant

  • the spore coat does not localize to the spore surface but self-assembles into aggregates in the mother cell cytoplasm [Pubmed|22171814]
  • The protein

    Catalyzed reaction/ biological activity

  • uses ATP hydrolysis to drive self-assembly into static filaments [Pubmed|23267091]
  • ATP hydrolysis drives polymerization of a nucleotide-free filament [Pubmed|23267091]
  • ploymerization depends on a critical threshold concentration of SpoIVA that is only achieved once the protein is recruited to the surface of the developing spore [Pubmed|23267091]
  • ATP + H2O --> ADP + H+ + phosphate (according to UniProt)
  • [SW|Domains]

  • contains a Walker A ATPase domain
  • Modification

  • phosphorylated on Arg-454 [pubmed|31221751]
  • [SW|Localization]

  • innermost protein of the spore coat basement [Pubmed|22171814]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|1729246,15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|1729246,15699190,15383836]
  • view in new tab

    Biological materials


  • BKE22800 ([gene|A25C1530DA7BB007A288E525404E9F775E219FE8|spoIVA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTGATCCCCTCCCGGAC, downstream forward: _UP4_TAATACCGGTAGACCTCTTT
  • BKK22800 ([gene|A25C1530DA7BB007A288E525404E9F775E219FE8|spoIVA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTGATCCCCTCCCGGAC, downstream forward: _UP4_TAATACCGGTAGACCTCTTT
  • References


  • 22192522,23202530,26418292,28408070,29355854
  • Original publications

  • 8748030,15699190,1729246,8936302,1729247,9922240,7592342,8299942,1691789,12644503,18691972,17427285,19775244,22171814,15383836,23267091,19702880,22262582,24810258,25854653,26387458,31221751,31597735