SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


ATPase, spore coat morphogenetic protein, anchors the spore coat to the spore surface via [protein|BBDA32A4EE3389D6F4404F7B3DA9E13AC7BF8055|SpoVM]
55.01 kDa
protein length
492 aa Sequence Blast
gene length
1479 bp Sequence Blast
initiation of spore coat assembly
ATPase, basement layer protein for spore coat assembly

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Class I]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,386,195 2,387,673

    Phenotypes of a mutant

  • the spore coat does not localize to the spore surface but self-assembles into aggregates in the mother cell cytoplasm [Pubmed|22171814]
  • The protein

    Catalyzed reaction/ biological activity

  • uses ATP hydrolysis to drive self-assembly into static filaments [Pubmed|23267091]
  • ATP hydrolysis drives polymerization of a nucleotide-free filament [Pubmed|23267091]
  • ploymerization depends on a critical threshold concentration of SpoIVA that is only achieved once the protein is recruited to the surface of the developing spore [Pubmed|23267091]
  • ATP + H2O --> ADP + H+ + phosphate (according to UniProt)
  • [SW|Domains]

  • contains a Walker A ATPase domain
  • Modification

  • phosphorylated on Arg-454 [pubmed|31221751]
  • [SW|Localization]

  • innermost protein of the spore coat basement [Pubmed|22171814]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|1729246,15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|1729246,15699190,15383836]
  • view in new tab

    Biological materials


  • BKE22800 ([gene|A25C1530DA7BB007A288E525404E9F775E219FE8|spoIVA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTGATCCCCTCCCGGAC, downstream forward: _UP4_TAATACCGGTAGACCTCTTT
  • BKK22800 ([gene|A25C1530DA7BB007A288E525404E9F775E219FE8|spoIVA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTGATCCCCTCCCGGAC, downstream forward: _UP4_TAATACCGGTAGACCTCTTT
  • References


  • 22192522,23202530,26418292,28408070,29355854
  • Original publications

  • 8748030,15699190,1729246,8936302,1729247,9922240,7592342,8299942,1691789,12644503,18691972,17427285,19775244,22171814,15383836,23267091,19702880,22262582,24810258,25854653,26387458,31221751,31597735