SubtiBank SubtiBank
ydbP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydbP

similar to thioredoxin
locus
BSU_04550
pI
4.39
mw
12.29 kDa
protein length
106 aa Sequence Blast
gene length
321 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.4|Electron transport/ other/ based on similarity]
  • Gene

    Coordinates
    507,753 508,073

    The protein

    Protein family

  • [SW|Thioredoxin family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|4E5C84FDC8FE2FEFF47306C91ECAB7F17D3E38E9|TrxA]
  • [SW|Domains]

  • Thioredoxin domain (aa 1-106) (according to UniProt)
  • Structure

  • [PDB|4RUV] (from ''Staphylococcus aureus'', 57% identity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|A245594D3F37ACE6B99855DDDFEC27F7F21579E4|ydbP]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C109 (ydbP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2107 NBRP B. subtilis, Japan]
  • BKE04550 ([gene|A245594D3F37ACE6B99855DDDFEC27F7F21579E4|ydbP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTCACATCTCCTTTT, downstream forward: _UP4_ATAAGCTAATTCGTTAAACA
  • BKK04550 ([gene|A245594D3F37ACE6B99855DDDFEC27F7F21579E4|ydbP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTCACATCTCCTTTT, downstream forward: _UP4_ATAAGCTAATTCGTTAAACA
  • References

  • 10482513