SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to thioredoxin
12.29 kDa
protein length
106 aa Sequence Blast
gene length
321 bp Sequence Blast

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.4|Electron transport/ other/ based on similarity]
  • Gene

    507,753 508,073

    The protein

    Protein family

  • [SW|Thioredoxin family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|4E5C84FDC8FE2FEFF47306C91ECAB7F17D3E38E9|TrxA]
  • [SW|Domains]

  • Thioredoxin domain (aa 1-106) (according to UniProt)
  • Structure

  • [PDB|4RUV] (from ''Staphylococcus aureus'', 57% identity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C109 (ydbP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE04550 ([gene|A245594D3F37ACE6B99855DDDFEC27F7F21579E4|ydbP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTCACATCTCCTTTT, downstream forward: _UP4_ATAAGCTAATTCGTTAAACA
  • BKK04550 ([gene|A245594D3F37ACE6B99855DDDFEC27F7F21579E4|ydbP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTCACATCTCCTTTT, downstream forward: _UP4_ATAAGCTAATTCGTTAAACA
  • References

  • 10482513