SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


Spo0A-P phosphatase, control of the phosphorelay
6.55 kDa
protein length
gene length
174 bp Sequence Blast
control of sporulation initiation
Spo0A-P phosphatase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|Phosphatases controlling the phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|Phosphatases controlling the phosphorelay]
  • Gene

    1,922,841 1,923,014

    The protein

    Protein family

  • spo0E family (with [protein|022933D89666CDD2ACE39BCBB78D349BAF8E899B|YisI]and [protein|A574974B6F4FF46DC69E03AE021651C67089866F|Spo0E], according to UniProt)
  • Paralogous protein(s)

  • [protein|A574974B6F4FF46DC69E03AE021651C67089866F|Spo0E]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials


  • BKE17920 ([gene|A2250786C40A23A5EBD830B3853DE5187B3D24EC|ynzD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGGGATGTATCCTTTCA, downstream forward: _UP4_TGATTGCAAAATAAAAAACC
  • BKK17920 ([gene|A2250786C40A23A5EBD830B3853DE5187B3D24EC|ynzD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGGGATGTATCCTTTCA, downstream forward: _UP4_TGATTGCAAAATAAAAAACC
  • References

  • 9068642,11679073,20817675