SubtiBank SubtiBank
rapI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rapI

response regulator aspartate phosphatase, antagonist of [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR]
locus
BSU_05010
pI
5.05
mw
46.40 kDa
protein length
391 aa Sequence Blast
gene length
1176 bp Sequence Blast
function
control of transfer of the mobile genetic element ICEBs1
product
response regulator aspartate phosphatase
essential
no
synonyms
yddL

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.2|Response regulator aspartate phosphatase]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.7|Control of transcription factor (other than two-component system)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.1|ICEBs1]
  • Gene

    Coordinates
    547,306 548,481

    The protein

    Catalyzed reaction/ biological activity

  • binds ImmR and inhibits its activity, this results in induction of the genes for the transfer of the mobile genetic element ICEBs1 [Pubmed|17511812]
  • Protein family

  • [SW|RAP family] (according to UniProt)
  • [SW|Domains]

  • six [SW|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
  • Effectors of protein activity

  • binding of [protein|F3E14B772A5DA9073ED806A9ADDD9B64F0DFDD5B|PhrI] indicates that neighbour cells do already contain the genetic element ICEBs1, this results in inactivation of RapI [Pubmed|17511812]
  • Structure

  • [PDB|4I1A] [Pubmed|23526881]
  • Expression and Regulation

    Operons

    genes
    [gene|A208B4564A50D7BE2630DE40E8FAAF3C16236EE4|rapI]-[gene|F3E14B772A5DA9073ED806A9ADDD9B64F0DFDD5B|phrI]
    description
    [Pubmed|11466295]

    sigma factors

  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|11466295], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11466295], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, [Pubmed|26582911], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • regulation

  • induced at high cell density ([SW|ComA]) [Pubmed|26582911]
  • view in new tab

    Biological materials

    Mutant

  • BKE05010 ([gene|A208B4564A50D7BE2630DE40E8FAAF3C16236EE4|rapI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAAAATTCCCCCATCCT, downstream forward: _UP4_TTGATGAAAATCAGCCGGAT
  • BKK05010 ([gene|A208B4564A50D7BE2630DE40E8FAAF3C16236EE4|rapI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAAAATTCCCCCATCCT, downstream forward: _UP4_TTGATGAAAATCAGCCGGAT
  • References

    Reviews

  • 24995588
  • Original publications

  • 11466295,17511812,23526881,26582911