SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to monooxygenase
36.40 kDa
protein length
333 aa Sequence Blast
gene length
1002 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    3,910,302 3,911,303

    The protein

    Paralogous protein(s)

  • [protein|A36E7D50E2EBD0F0109491FF2CAD2CA84372B2CF|YvbT], [protein|EDC3565D90D7059A4A4C66A13EB568420F6CECD4|CmoO], [protein|1432F56AD3D2B2BD82D8759CE4DC42C0D40C49C0|YceB]
  • Structure

  • [PDB|4US5] (from Streptomyces bottropensis, 39% identity) [pubmed|24554499]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10913069], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9535080], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|29271514,12642660,19575568], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • induced by cell wall stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]) [pubmed|29271514]
  • view in new tab

    Biological materials


  • MGNA-B233 (ywcH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38100 ([gene|A1DCFF8D225C87197104742E72A0D4F238BC30EB|ywcH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCTACCACCTCATCCT, downstream forward: _UP4_TGATCTTTAAAAAGCCCTGC
  • BKK38100 ([gene|A1DCFF8D225C87197104742E72A0D4F238BC30EB|ywcH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCTACCACCTCATCCT, downstream forward: _UP4_TGATCTTTAAAAAGCCCTGC
  • References

  • 10913069,9535080,14651647,24554499