SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


33.70 kDa
protein length
303 aa Sequence Blast
gene length
912 bp Sequence Blast
resistance to methyl hydroquinone and catechol

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    2,129,082 2,129,993

    The protein

    Protein family

  • [SW|extradiol ring-cleavage dioxygenase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|ACAFB2072E74CC059B492A31EF492028B96C569F|MhqO], [protein|7334017333600B876030056BE9247AD4E8996A1D|MhqA]
  • Structure

  • [PDB|3OAJ] ([protein|ACAFB2072E74CC059B492A31EF492028B96C569F|MhqO], 48% identical residues)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17725564], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|997B828A99D6D8460712C18ED0CE566B285C22DC|MhqR]: repression, [Pubmed|17725564], in [regulon|997B828A99D6D8460712C18ED0CE566B285C22DC|MhqR regulon]
  • regulation

  • induced by 2-methylhydroquinone ([protein|search|MhqR]) [Pubmed|17725564]
  • view in new tab

    Biological materials


  • MGNA-B436 (yodE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19570 ([gene|A1CB3DCF2EC78B9B0585CA6AC6F5BB37B8AF0208|mhqE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTCACTCCTATTTA, downstream forward: _UP4_GAACTTTAAAAGGGGGAATT
  • BKK19570 ([gene|A1CB3DCF2EC78B9B0585CA6AC6F5BB37B8AF0208|mhqE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTCTCACTCCTATTTA, downstream forward: _UP4_GAACTTTAAAAGGGGGAATT
  • References

  • 17407181,17725564