SubtiBank SubtiBank
yyzB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yyzB

unknown
locus
BSU_40460
pI
6.33
mw
7.77 kDa
protein length
gene length
204 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    4,159,253 4,159,456

    Biological materials

    Mutant

  • BKE40460 ([gene|A1A06149942A47E4E1E36952346A62B5B9662576|yyzB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAACCCTCCTTACCT, downstream forward: _UP4_TAAACCGATAACCGCTAAAA
  • BKK40460 ([gene|A1A06149942A47E4E1E36952346A62B5B9662576|yyzB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAACCCTCCTTACCT, downstream forward: _UP4_TAAACCGATAACCGCTAAAA