SubtiBank SubtiBank
rph
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rph

RNase PH, 3-5 exoribonuclease
locus
BSU_28370
pI
4.89
mw
26.53 kDa
protein length
245 aa Sequence Blast
gene length
738 bp Sequence Blast
function
3-5 exoribonuclease
product
RNase PH (EC 2.7.7.56)
essential
no
ec
2.7.7.56
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.1|Exoribonucleases]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    2,901,154 2,901,891

    The protein

    Catalyzed reaction/ biological activity

  • major player in the exonucleolytic maturation of CCA-containing tRNA precursors [Pubmed|15983136]
  • responsible for endonucleolytic cleavage of scRNA (''[gene|097C817A5A3E31F73F6ABC4AA95852A64E43A057|scr]'') [Pubmed|17576666]
  • phosphate + tRNA(n+1) --> ribonucleoside 5'-diphosphate + tRNA(n) (according to UniProt)
  • Protein family

  • [SW|RNase] PH family (single member, according to UniProt)
  • Structure

  • [PDB|1OYS]
  • Expression and Regulation

    Operons

    genes
    [gene|A18474CD50C2A1A83CF04C74098659BF1649B4DC|rph]-[gene|1BE734901DACBB56AB688C776F0AF8D298462518|ysnA]-[gene|13DF13F1EA21BC78035E5ED8B7AF2320235284A6|ysnB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE28370 ([gene|A18474CD50C2A1A83CF04C74098659BF1649B4DC|rph]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTACCTCCGATTGT, downstream forward: _UP4_TAAAGACAGAAAGGCTTGAT
  • BKK28370 ([gene|A18474CD50C2A1A83CF04C74098659BF1649B4DC|rph]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTACCTCCGATTGT, downstream forward: _UP4_TAAAGACAGAAAGGCTTGAT
  • labs

  • [SW|David Bechhofer], Mount Sinai School, New York, USA [http://www.mountsinai.org/Research/Centers%20Laboratories%20and%20Programs/Bechhofer%20Laboratory?citype=Physician&ciid=Bechhofer%20David%20H%201255565 Homepage]
  • [SW|Ciaran Condon], IBPC, Paris, France [http://www.ibpc.fr/UPR9073/condon/index_en.html Homepage]
  • References

    Reviews

  • 31464530
  • Original Publications

  • 17576666,15805522,19880604,14767080,1624460,15983136