SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


RNase PH, 3-5 exoribonuclease
26.53 kDa
protein length
245 aa Sequence Blast
gene length
738 bp Sequence Blast
3-5 exoribonuclease
RNase PH (EC

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW|Exoribonucleases]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • Gene

    2,901,154 2,901,891

    The protein

    Catalyzed reaction/ biological activity

  • major player in the exonucleolytic maturation of CCA-containing tRNA precursors [Pubmed|15983136]
  • responsible for endonucleolytic cleavage of scRNA (''[gene|097C817A5A3E31F73F6ABC4AA95852A64E43A057|scr]'') [Pubmed|17576666]
  • phosphate + tRNA(n+1) --> ribonucleoside 5'-diphosphate + tRNA(n) (according to UniProt)
  • Protein family

  • [SW|RNase] PH family (single member, according to UniProt)
  • Structure

  • [PDB|1OYS]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE28370 ([gene|A18474CD50C2A1A83CF04C74098659BF1649B4DC|rph]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTACCTCCGATTGT, downstream forward: _UP4_TAAAGACAGAAAGGCTTGAT
  • BKK28370 ([gene|A18474CD50C2A1A83CF04C74098659BF1649B4DC|rph]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTACCTCCGATTGT, downstream forward: _UP4_TAAAGACAGAAAGGCTTGAT
  • labs

  • [SW|David Bechhofer], Mount Sinai School, New York, USA [ Homepage]
  • [SW|Ciaran Condon], IBPC, Paris, France [ Homepage]
  • References


  • 31464530
  • Original Publications

  • 17576666,15805522,19880604,14767080,1624460,15983136