SubtiBank SubtiBank
yfjA
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

yfjA

unknown
locus
BSU08170
pI
4.86
mw
11.89 kDa
protein length
104 aa Sequence Blast
gene length
312 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    889,372 → 889,686

    The protein

    Protein family

  • WXG100 superfamily (pfam06013) [Pubmed|11973144]
  • Expression and Regulation

    Operons

    genes
    [gene|A177DF098115F85F23A1D42EFB07D294B515830F|yfjA]-[gene|F130D13E1F9C03157ECF37C91F90F2487CF22B09|yfjB]-[gene|C832113D9C59F56C6CDA695B589B1E001C881ABE|yfjC]-[gene|F18F68234236D28894084695429DBF47AA061BE1|yfjD]-[gene|D0F98493600C1BED7118C83E6079AEF0B0D460FB|yfjE]-[gene|642A9A6770EF067A0EC7F51A08940C330EB3610A|yfjF]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C288 (yfjA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2286 NBRP B. subtilis, Japan]
  • BKE08170 (Δ[gene|A177DF098115F85F23A1D42EFB07D294B515830F|yfjA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTTTTGTCCCCTGCCTT, downstream forward: _UP4_CATAAACTCGGGAGGTGAAC
  • BKK08170 (Δ[gene|A177DF098115F85F23A1D42EFB07D294B515830F|yfjA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTTTTGTCCCCTGCCTT, downstream forward: _UP4_CATAAACTCGGGAGGTGAAC
  • References

  • 11973144