SubtiBank SubtiBank
tepA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tepA

orphan [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]-like [SW|germination] protease, contributes to SASP degradation
locus
BSU16790
pI
5.57
mw
24.10 kDa
protein length
245 aa Sequence Blast
gene length
738 bp Sequence Blast
function
degradation of SASPs
product
[SW|germination] protease
essential
no
synonyms
ymfB,ylxI

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.3|Proteolysis during sporulation/ germination]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • Gene

    Coordinates
    1,751,201 1,751,938

    The protein

    Catalyzed reaction/ biological activity

  • degradation of SASPs in germinating spores [Pubmed|23927687]
  • Protein family

  • Peptidase S14 family (with [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP], according to UniProt)
  • Effectors of protein activity

  • activity requires [protein|A7C95C19ABD47456351C05A88B14F932BDEF1059|YlzJ] [Pubmed|23927687]
  • [SW|Localization]

  • inner spore membrane [Pubmed|26731423]
  • Expression and Regulation

    Operons

    genes
    [gene|A16C6515D185E3A268D57D77F28EF7EF9AF9FE05|tepA]-[gene|A7C95C19ABD47456351C05A88B14F932BDEF1059|ylzJ]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|23123912], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, [Pubmed|23123912], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed late during [SW|sporulation] in the forespore ([protein|search|SigG], [SW|SpoVT]) [Pubmed|23123912]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B377 (ymfB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1376 NBRP B. subtilis, Japan]
  • GP1120 (spc), available in [SW|Jörg Stülke]'s lab
  • BKE16790 ([gene|A16C6515D185E3A268D57D77F28EF7EF9AF9FE05|tepA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCGCTTTCATCCTTTC, downstream forward: _UP4_AAAGAAGAAGGACGGATGAT
  • BKK16790 ([gene|A16C6515D185E3A268D57D77F28EF7EF9AF9FE05|tepA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCGCTTTCATCCTTTC, downstream forward: _UP4_AAAGAAGAAGGACGGATGAT
  • References

  • 23123912,22383849,10455123,23927687,26731423