SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


sodium/proton-dependent alanine transporter
51.43 kDa
protein length
484 aa Sequence Blast
gene length
1455 bp Sequence Blast
uptake of alanine
sodium/proton-dependent alanine transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|Other amino acid transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of serine/ glycine/ alanine]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of alanine/ serine]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    2,841,611 2,843,065

    The protein

    Protein family

  • [SW|Alanine or glycine:cation symporter (AGCS) (TC 2.A.25) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|A69E7536DFE6353C4CD1B09D1258C88BF0FB8B4D|YflA], [protein|B84BE9F5BEFE3A295ED5580D66040CD28609A6A1|AlsT], [protein|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|GlnT]
  • Expression and Regulation



    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • view in new tab

    Biological materials


  • MGNA-A821 (yrbD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27810 ([gene|A10EA56A7EDA2DF712B5BB87D94A818E39940B44|yrbD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAGCTTCCCCCTCACT, downstream forward: _UP4_TGAACATACTAAAACCGGCC
  • BKK27810 ([gene|A10EA56A7EDA2DF712B5BB87D94A818E39940B44|yrbD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAGCTTCCCCCTCACT, downstream forward: _UP4_TGAACATACTAAAACCGGCC
  • References

  • 25755103