SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


L-lactate dehydrogenase
34.00 kDa
protein length
321 aa Sequence Blast
gene length
966 bp Sequence Blast
overflow metabolism, fermentation
L-lactate dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Overflow metabolism]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]
  • Gene

    329,774 330,739

    The protein

    Catalyzed reaction/ biological activity

  • (S)-lactate + NAD+ --> H+ + NADH + pyruvate (according to UniProt)
  • Protein family

  • LDH/MDH superfamily (with [protein|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|Mdh], according to UniProt)
  • Modification

  • phosphorylation on Tyr-224 [Pubmed|17218307]
  • Structure

  • [PDB|3PQE]
  • [PDB|A general discussion of Ldh structure]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10809684], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex]: repression, [Pubmed|16207915], in [regulon|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex regulon]
  • regulation

  • induced under anaerobic conditions ([protein|search|Rex]) [Pubmed|16207915]
  • view in new tab

    Biological materials


  • BKE03050 ([gene|A0DD68FE90FD13DF03496321AB2DAAADF9F4230D|ldh]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAATCATCCTTCCAGGG, downstream forward: _UP4_TAACCGCAACTTTAGAGTAA
  • BKK03050 ([gene|A0DD68FE90FD13DF03496321AB2DAAADF9F4230D|ldh]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAATCATCCTTCCAGGG, downstream forward: _UP4_TAACCGCAACTTTAGAGTAA
  • GP2597 ([gene|A0DD68FE90FD13DF03496321AB2DAAADF9F4230D|ldh]::tet comIQ12L) (in DK1042) available in [SW|Jörg Stülke]'s lab
  • References

  • 17586670,16207915,16207915,17218307,22862776