SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional repressor, regulates zinc homeostasis
16.42 kDa
protein length
145 aa Sequence Blast
gene length
438 bp Sequence Blast
regulation of zinc homeostasis([gene|75DB07A2704FEC2932BD0CDD24E2B3454E9551E1|zagA], [gene|D33A144568CAF32FFE4A2A46BE67573DB66FC1A1|znuA]-[gene|6B5D4FD32CCE72C99B915B0F1EB4B8E8D42A04B3|znuC]-[gene|EE212953BC83BD6D69BF769D6E917F4F954BE1E2|znuB])
transcriptional repressor ([SW|Fur family])

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW|Zinc]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    2,591,428 2,591,865

    The protein

    Protein family

  • [SW|Fur family]
  • Paralogous protein(s)

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur], [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • Effectors of protein activity

  • sequential binding of zinc (two atoms per monomer) results in the activation of Zur dimer and thus in repression of the genes of the [SW|Zur regulon] [Pubmed|21821657]
  • zinc binding is negatively co-operative resulting in step-wise induction of the genes of the [SW|Zur regulon] upon zinc depletion [Pubmed|27561249]
  • Structure

  • [PDB|2FE3] ([protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR], 35% identity) [pubmed|16925555]
  • [SW|Localization]

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation


    view in new tab

    Biological materials


  • 1A904 ( ''zur''::''spec''), [Pubmed|12029044], available at [ BGSC]
  • BKE25100 ([gene|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAGGGTCCCCCTTTTC, downstream forward: _UP4_TAAAATGCGTATATATGAAA
  • BKK25100 ([gene|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAGGGTCCCCCTTTTC, downstream forward: _UP4_TAAAATGCGTATATATGAAA
  • labs

  • [SW|John Helmann], Cornell University, USA [ Homepage]
  • References

  • 21821657,18344368,14563870,12904577,16493705,9811636,12426338,19648245,25649915,27561249,16925555