SubtiBank SubtiBank
srtN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

srtN

protein deacetylase and lipoamidase
locus
BSU_09650
pI
5.13
mw
27.27 kDa
protein length
247 aa Sequence Blast
gene length
744 bp Sequence Blast
function
control of [protein|search|AcsA ]activity
product
NAD(+)-dependent deacetylase and lipoamidase
essential
no
synonyms
yhdZ

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.5|Protein acetylases/ deacetylases]
  • Gene

    Coordinates
    1,040,094 1,040,837

    Phenotypes of a mutant

  • increased 2-oxoglutarate dehydrogenase activity [pubmed|28900027]
  • The protein

    Catalyzed reaction/ biological activity

  • NAD an acetylprotein = nicotinamide O-acetyl-ADP-ribose a protein (according to Swiss-Prot)
  • deacetylates (and thereby activates) [protein|6671E7D85E99D349679F0E9D825DC035D10FFD2E|AcsA] (together with [protein|1255813797A83D835E0656A2AAAD361B5BB2094B|AcuC]) [Pubmed|19136592]
  • removes lipoic acid from E2 subunits of ketoacid dehydrogenases and from the H protein of the glycine cleavage system [pubmed|28900027]
  • Protein family

  • sirtuin family (single member, according to UniProt)
  • Structure

  • [PDB|1MA3] (from ''Archaeoglobus fulgidus'', 40% identity) [Pubmed|12408821]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B488 (yhdZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1487 NBRP B. subtilis, Japan]
  • GP1210 (''[gene|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN]''::''cat''), available in [SW|Jörg Stülke]'s lab
  • 1A888 ( ''srtN''::''spec''), [Pubmed|19136592], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A888&Search=1A888 BGSC]
  • BKE09650 ([gene|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTCAACACCGCCTTTTT, downstream forward: _UP4_TGAGCCGCTTTATGCGCCTC
  • BKK09650 ([gene|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTCAACACCGCCTTTTT, downstream forward: _UP4_TGAGCCGCTTTATGCGCCTC
  • References

  • 19136592,26708127,12408821,26098117,28900027