SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


protein deacetylase and lipoamidase
27.27 kDa
protein length
247 aa Sequence Blast
gene length
744 bp Sequence Blast
control of [protein|search|AcsA ]activity
NAD(+)-dependent deacetylase and lipoamidase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein acetylases/ deacetylases]
  • Gene

    1,040,094 1,040,837

    Phenotypes of a mutant

  • increased 2-oxoglutarate dehydrogenase activity [pubmed|28900027]
  • The protein

    Catalyzed reaction/ biological activity

  • H2O + N6-acetyl-L-lysyl-[protein] + NAD+ --> 2''-O-acetyl-ADP-D-ribose + L-lysyl-[protein] + nicotinamide (according to UniProt)
  • deacetylates (and thereby activates) [protein|6671E7D85E99D349679F0E9D825DC035D10FFD2E|AcsA] (together with [protein|1255813797A83D835E0656A2AAAD361B5BB2094B|AcuC]) [Pubmed|19136592]
  • removes lipoic acid from E2 subunits of ketoacid dehydrogenases and from the H protein of the glycine cleavage system [pubmed|28900027]
  • Protein family

  • sirtuin family (single member, according to UniProt)
  • [SW|Domains]

  • Deacetylase sirtuin-type domain (aa 2-247) (according to UniProt)
  • Structure

  • [PDB|1MA3] (from ''Archaeoglobus fulgidus'', 40% identity) [Pubmed|12408821]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B488 (yhdZ::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1210 (''[gene|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN]''::''cat''), available in [SW|Jörg Stülke]'s lab
  • 1A888 ( ''srtN''::''spec''), [Pubmed|19136592], available at [ BGSC]
  • BKE09650 ([gene|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTCAACACCGCCTTTTT, downstream forward: _UP4_TGAGCCGCTTTATGCGCCTC
  • BKK09650 ([gene|A0A6CB19191A251BB5600C18E039978A9A34933C|srtN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTCAACACCGCCTTTTT, downstream forward: _UP4_TGAGCCGCTTTATGCGCCTC
  • References

  • 19136592,26708127,12408821,26098117,28900027