SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


low affinity potassium channel [protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|KtrC]-[protein|A0952B75E5BD0D09B0F4C257822428640998558B|KtrD], integral membrane subunit
49.26 kDa
protein length
449 aa Sequence Blast
gene length
1350 bp Sequence Blast
potassium uptake
low affinity potassium channel [protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|KtrC]-[protein|A0952B75E5BD0D09B0F4C257822428640998558B|KtrD], integral membrane subunit

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW|Potassium uptake/ export]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,416,067 1,417,416

    The protein

    Catalyzed reaction/ biological activity

  • uptake of potassium
  • Protein family

  • TrkH potassium transport family (with [protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|KtrB], according to UniProt)
  • Paralogous protein(s)

  • [protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|KtrB]
  • Kinetic information

  • the [protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|KtrC]-[protein|search|KtrD ]channel has a low affinity for potassium,this is determined by KtrD [pubmed|30753894]
  • Structure

  • [PDB|4J7C] (the [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|KtrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|KtrB] complex, 36% identity) [Pubmed|23598340]
  • [SW|Localization]

  • integral membrane protein [Pubmed|12562800]
  • Expression and Regulation




  • constitutively expressed
  • view in new tab

    Biological materials


  • MGNA-B317 (ykrM::erm), available at the [ NBRP B. subtilis, Japan]
  • GHB12 (''ktrD''::''tet''), [Pubmed|12562800], available in [SW|Erhard Bremer]'s and [SW|Jörg Stülke]'s labs
  • GP2030 (''ktrD''::''tet''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
  • 1A956 (''ktrD''::''tet''), [Pubmed|12562800], available at [ BGSC]
  • BKE13500 ([gene|A0952B75E5BD0D09B0F4C257822428640998558B|ktrD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAATCCTTCTGCCT, downstream forward: _UP4_TAGGCAAAACACCGCATATT
  • BKK13500 ([gene|A0952B75E5BD0D09B0F4C257822428640998558B|ktrD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAATCCTTCTGCCT, downstream forward: _UP4_TAGGCAAAACACCGCATATT
  • Expression vector

  • pGP2996: (IPTG inducible expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP2434 ''ktrD-3xFLAG spc'' (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Erhard Bremer], University of Marburg, Germany [ homepage]
  • References


  • 21680052,27935846,25838295
  • Original publications

  • 12562800,23598340,28420751,28504641,30753894