SubtiBank SubtiBank
mhqN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mhqN

similar to NAD(P)H nitroreductase
locus
BSU05480
pI
5.56
mw
23.41 kDa
protein length
206 aa Sequence Blast
gene length
621 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ydfN

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    596,478 597,098

    The protein

    Protein family

  • nitroreductase family (according to Swiss-Prot)
  • Structure

  • [PDB|3BEM]
  • Expression and Regulation

    Operons

    genes
    [gene|A0842DD5F1B13AC15C95F18751E7836DF31B262A|mhqN]-[gene|ACAFB2072E74CC059B492A31EF492028B96C569F|mhqO]-[gene|B4384C8C0874BAA7822E9B6DCAB57790018271D8|mhqP]
    description
    [Pubmed|17725564]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17725564], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|997B828A99D6D8460712C18ED0CE566B285C22DC|MhqR]: repression, [Pubmed|17725564], in [regulon|997B828A99D6D8460712C18ED0CE566B285C22DC|MhqR regulon]
  • regulation

  • induced by catechol and 2-methylhydroquinone ([protein|search|MhqR]) [Pubmed|17725564]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C153 (ydfN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2151 NBRP B. subtilis, Japan]
  • BKE05480 ([gene|A0842DD5F1B13AC15C95F18751E7836DF31B262A|mhqN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGCTACACTCCCTTT, downstream forward: _UP4_TATATGTAAAAGGAGCGGAT
  • BKK05480 ([gene|A0842DD5F1B13AC15C95F18751E7836DF31B262A|mhqN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGCTACACTCCCTTT, downstream forward: _UP4_TATATGTAAAAGGAGCGGAT
  • References

  • 17407181,17725564,27965289