SubtiBank SubtiBank
mhqN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mhqN

similar to NAD(P)H nitroreductase
locus
BSU_05480
pI
5.56
mw
23.41 kDa
protein length
206 aa Sequence Blast
gene length
621 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ydfN

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    596,478 597,098

    The protein

    Protein family

  • [SW|nitroreductase family] (according to UniProt)
  • Structure

  • [PDB|3BEM]
  • Expression and Regulation

    Operons

    genes
    [gene|A0842DD5F1B13AC15C95F18751E7836DF31B262A|mhqN]-[gene|ACAFB2072E74CC059B492A31EF492028B96C569F|mhqO]-[gene|B4384C8C0874BAA7822E9B6DCAB57790018271D8|mhqP]
    description
    [Pubmed|17725564]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17725564], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|997B828A99D6D8460712C18ED0CE566B285C22DC|MhqR]: repression, [Pubmed|17725564], in [regulon|997B828A99D6D8460712C18ED0CE566B285C22DC|MhqR regulon]
  • regulation

  • induced by catechol and 2-methylhydroquinone ([protein|search|MhqR]) [Pubmed|17725564]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C153 (ydfN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2151 NBRP B. subtilis, Japan]
  • BKE05480 ([gene|A0842DD5F1B13AC15C95F18751E7836DF31B262A|mhqN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGCTACACTCCCTTT, downstream forward: _UP4_TATATGTAAAAGGAGCGGAT
  • BKK05480 ([gene|A0842DD5F1B13AC15C95F18751E7836DF31B262A|mhqN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGCTACACTCCCTTT, downstream forward: _UP4_TATATGTAAAAGGAGCGGAT
  • References

  • 17407181,17725564,27965289