SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


N-terminal fragment of the Y family DNA polymerase [protein|A04F698C8836E84991BC875BCB7B1460D8E74A8E|YozK]-[protein|ED0A85A8A5FCD12C99507EB033F88586521A7C47|YobH]
12.84 kDa
protein length
115 aa Sequence Blast
gene length
349 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • The protein

    Protein family

  • [SW|DNA polymerase type-Y family] (according to UniProt)
  • [SW|Domains]

  • [SW|UmuC domain] (aa 12-115) (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • MGNA-B409 (yozK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE18940 ([gene|A04F698C8836E84991BC875BCB7B1460D8E74A8E|yozK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCTCACGTGGAAATTGTG, downstream forward: _UP4_TAATCTTTTTTAGATGCAGG
  • BKK18940 ([gene|A04F698C8836E84991BC875BCB7B1460D8E74A8E|yozK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCTCACGTGGAAATTGTG, downstream forward: _UP4_TAATCTTTTTTAGATGCAGG
  • References

  • 16267290,27766092,30916324