SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to Na+-dependent transporter
30.46 kDa
protein length
306 aa Sequence Blast
gene length
921 bp Sequence Blast

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    178,665 179,585

    The protein


  • [PDB|4N7W] (from Yersinia frederiksenii, 25% identity) [pubmed|24317697]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE01590 ([gene|A045C46E8FC52CD2EC3CBBDBA83F7DBCF20F3450|ybaS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTCTCCCCAATACAC, downstream forward: _UP4_TTGCAGAAGGCATAAAAAAA
  • BKK01590 ([gene|A045C46E8FC52CD2EC3CBBDBA83F7DBCF20F3450|ybaS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTCTCCCCAATACAC, downstream forward: _UP4_TTGCAGAAGGCATAAAAAAA
  • References

    Research papers

  • 24317697