SubtiBank SubtiBank
ybaS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybaS

similar to Na+-dependent transporter
locus
BSU_01590
pI
10.18
mw
30.46 kDa
protein length
306 aa Sequence Blast
gene length
921 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    178,665 179,585

    The protein

    Structure

  • [PDB|4N7W] (from Yersinia frederiksenii, 25% identity) [pubmed|24317697]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|A045C46E8FC52CD2EC3CBBDBA83F7DBCF20F3450|ybaS]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE01590 ([gene|A045C46E8FC52CD2EC3CBBDBA83F7DBCF20F3450|ybaS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTCTCCCCAATACAC, downstream forward: _UP4_TTGCAGAAGGCATAAAAAAA
  • BKK01590 ([gene|A045C46E8FC52CD2EC3CBBDBA83F7DBCF20F3450|ybaS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTCTCCCCAATACAC, downstream forward: _UP4_TTGCAGAAGGCATAAAAAAA
  • References

    Research papers

  • 24317697