SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


putative spore coat protein
18.44 kDa
protein length
170 aa Sequence Blast
gene length
513 bp Sequence Blast
protection of the spore
putative spore coat protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat protein/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    3,542,179 3,542,691

    The protein


  • [PDB|2RBD] (from B. halodurans, 57% identity)
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
  • additional information

  • [protein|search|translation] is likely to require [protein|search|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • view in new tab

    Biological materials


  • MGNA-B619 (yvdQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34510 ([gene|A0392469FB5B36C030C003ECC0EC39F71BBC5CD0|yvdQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATTCTCCTCCCAT, downstream forward: _UP4_TAATGGCAAAGGCATATACA
  • BKK34510 ([gene|A0392469FB5B36C030C003ECC0EC39F71BBC5CD0|yvdQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATTCTCCTCCCAT, downstream forward: _UP4_TAATGGCAAAGGCATATACA
  • References

  • 16497325