SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


putative spore coat protein
18.44 kDa
protein length
170 aa Sequence Blast
gene length
513 bp Sequence Blast
protection of the spore
putative spore coat protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat protein/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    3,542,179 3,542,691

    The protein


  • [PDB|2RBD] (from B. halodurans, 57% identity)
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
  • additional information

  • [protein|search|translation] is likely to require [protein|search|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • view in new tab

    Biological materials


  • MGNA-B619 (yvdQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34510 ([gene|A0392469FB5B36C030C003ECC0EC39F71BBC5CD0|yvdQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATTCTCCTCCCAT, downstream forward: _UP4_TAATGGCAAAGGCATATACA
  • BKK34510 ([gene|A0392469FB5B36C030C003ECC0EC39F71BBC5CD0|yvdQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATTCTCCTCCCAT, downstream forward: _UP4_TAATGGCAAAGGCATATACA
  • References

  • 16497325