SubtiBank SubtiBank
yvdQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvdQ

putative spore coat protein
locus
BSU34510
pI
5.81
mw
18.44 kDa
protein length
170 aa Sequence Blast
gene length
513 bp Sequence Blast
function
protection of the spore
product
putative spore coat protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.2|Spore coat protein/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • Gene

    Coordinates
    3,542,179 3,542,691

    The protein

    Structure

  • [PDB|2RBD] (from B. halodurans, 57% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|A0392469FB5B36C030C003ECC0EC39F71BBC5CD0|yvdQ]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
  • additional information

  • [protein|search|translation] is likely to require [protein|search|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B619 (yvdQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1618 NBRP B. subtilis, Japan]
  • BKE34510 ([gene|A0392469FB5B36C030C003ECC0EC39F71BBC5CD0|yvdQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATTCTCCTCCCAT, downstream forward: _UP4_TAATGGCAAAGGCATATACA
  • BKK34510 ([gene|A0392469FB5B36C030C003ECC0EC39F71BBC5CD0|yvdQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATTCTCCTCCCAT, downstream forward: _UP4_TAATGGCAAAGGCATATACA
  • References

  • 16497325