SubtiBank SubtiBank
yoyJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yoyJ

toxin (weakly active)
locus
BSU_20999
pI
9.52
mw
10.00 kDa
protein length
gene length
252 bp Sequence Blast
function
unknown
product
toxin
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.1|Type 1 TA systems]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,219,514 2,219,765

    The protein

    Catalyzed reaction/ biological activity

  • weakly active toxin [pubmed|29414903]
  • Expression and Regulation

    Operons

    genes
    [gene|961DB64225CEF84D80982ADBDC9BBBCDF5049132|yonT]-[gene|A01986F131F973AFE08CC28E89CB70FD2BED06EE|yoyJ]-[gene|21DF0BF609522F9FFF636A9AF99779A459166A8D|yonU]-[gene|ED02B21A2296C6A5A19007810D0416FCBAF5B9ED|yonV]
    description
    [Pubmed|29414903]
    view in new tab

    Biological materials

    Mutant

  • BKE20999 ([gene|A01986F131F973AFE08CC28E89CB70FD2BED06EE|yoyJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20999 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCATTCCCCTTTAGCTTA, downstream forward: _UP4_TAATCATATAGGCCTCATGG
  • BKK20999 ([gene|A01986F131F973AFE08CC28E89CB70FD2BED06EE|yoyJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20999 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCATTCCCCTTTAGCTTA, downstream forward: _UP4_TAATCATATAGGCCTCATGG
  • References

    Reviews

  • 31075979
  • Research papers

  • 29414903