SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


3-methyl-2-oxobutanoate hydroxymethyltransferase
29.61 kDa
protein length
277 aa Sequence Blast
gene length
834 bp Sequence Blast
biosynthesis of coenzyme A
3-methyl-2-oxobutanoate hydroxymethyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of coenzyme A]
  • Gene

    2,353,839 2,354,672

    The protein

    Catalyzed reaction/ biological activity

  • 5,10-methylenetetrahydrofolate + 3-methyl-2-oxobutanoate + H2O = tetrahydrofolate + 2-dehydropantoate (according to Swiss-Prot)
  • Structure

  • [PDB|3EZ4] (from ''Burkholderia pseudomallei'', 44% identity, 64% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Biological materials


  • PA126 (''panB''::''cat''), available in [SW|Jörg Stülke]'s lab
  • BKE22430 ([gene|A0001681244113B808757281C1B70C0C94F28A27|panB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCTCCTCCTCATG, downstream forward: _UP4_GTGCTTGACGGCTTGTACGG
  • BKK22430 ([gene|A0001681244113B808757281C1B70C0C94F28A27|panB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCTCCTCCTCATG, downstream forward: _UP4_GTGCTTGACGGCTTGTACGG
  • References

  • 21383089,27120414