SubtiBank SubtiBank
thyB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

thyB

thymidylate synthase B
locus
BSU_21820
pI
6.27
mw
30.39 kDa
protein length
264 aa Sequence Blast
gene length
795 bp Sequence Blast
function
biosynthesis of thymidine nucleotides
product
thymidylate synthase B
essential
no
ec
2.1.1.45
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.4|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    2,297,106 2,297,900

    The protein

    Catalyzed reaction/ biological activity

  • (6R)-5,10-methylene-5,6,7,8-tetrahydrofolate + dUMP --> 7,8-dihydrofolate + dTMP (according to UniProt)
  • Protein family

  • thymidylate synthase family (with [protein|6FE1D3C4D4DF86DE2D3D9A143A1DCFE120F13F5F|ThyA], according to UniProt)
  • Paralogous protein(s)

  • [protein|6FE1D3C4D4DF86DE2D3D9A143A1DCFE120F13F5F|ThyA]
  • Modification

  • phosphorylated on Arg-102 [Pubmed|22517742]
  • Structure

  • [PDB|3IX6] (from ''Brucella melitensis'', 67% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|8B515C789439354F870023E69077D2C1D709E046|ypjP]-[gene|2CB3BAF17F59A858D249619A436EF660CAA58DD5|ypjQ]-[gene|9F9643D51E9ABA537892B19312491697CECDDCCF|thyB]-[gene|B740E971204AC14BA456B8C93A86D4BDC29524FF|dfrA]-[gene|9D1DAA5E69DD12FDE0FB33EA0863E0CB214120EC|ypkP]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|9F9643D51E9ABA537892B19312491697CECDDCCF|thyB]-[gene|B740E971204AC14BA456B8C93A86D4BDC29524FF|dfrA]
    description
    [Pubmed|2840350]

    regulatory mechanism

  • [protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN]: activation, weak, in [regulon|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN regulon]
  • regulation

  • weak induction in the presence of glucose ([protein|search|CcpN]) [Pubmed|19732150]
  • view in new tab

    Biological materials

    Mutant

  • BKE21820 ([gene|9F9643D51E9ABA537892B19312491697CECDDCCF|thyB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTTCATCCTTTAAA, downstream forward: _UP4_GTATGATTTCATTCATTTTT
  • BKK21820 ([gene|9F9643D51E9ABA537892B19312491697CECDDCCF|thyB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTTCATCCTTTAAA, downstream forward: _UP4_GTATGATTTCATTCATTTTT
  • References

    Reviews

  • 7574499
  • Original publications

  • 418407,19732150,2840350,22517742,29150519