SubtiBank SubtiBank
ylxS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ylxS

similar to ribosome maturation protein
locus
BSU_16590
pI
4.48
mw
17.48 kDa
protein length
156 aa Sequence Blast
gene length
471 bp Sequence Blast
function
ribosome maturation
product
unknown
essential
no
synonyms
ymxA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.13|Translation/ other/ based on similarity]
  • Gene

    Coordinates
    1,731,776 1,732,246

    The protein

    Protein family

  • RimP family (single member, according to UniProt)
  • Structure

  • [PDB|1IB8] (from ''Streptococcus pneumoniae'', 41% identity) [Pubmed|11493012]
  • Expression and Regulation

    Operons

    genes
    [gene|9F6C447900410BF64409E5C41A11C76968DADAFA|ylxS]-[gene|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|nusA]-[gene|F4097349A563503468A2A14F062AEAC532C7917A|ylxR]-[gene|7BFA65857F69855DBB3BB64D93B4ED2F09DC705B|rplGA]-[gene|378B77412D0DEA220A97DEC246410509D9B74D46|infB]-[gene|24835CE6CD2E1F183DB9121F29A63101718B5DF9|ylxP]-[gene|B3119A40393A288EF34FC3E9839B6E40AC6A6EA0|rbfA]
    description
    [Pubmed|8491709]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8491709], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528,26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|NusA]: attenuation, [protein|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|NusA] stimulates termination [Reference|http://www.nature.com/articles/nmicrobiol20157], in [regulon|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|NusA regulon]
  • regulation

  • autoregulation [SW|NusA] [http://www.nature.com/articles/nmicrobiol20157 reference]
  • induced by glucose [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • BKE16590 ([gene|9F6C447900410BF64409E5C41A11C76968DADAFA|ylxS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTCCTCCTTGTGC, downstream forward: _UP4_TAATGAATACAAATGTTTTA
  • BKK16590 ([gene|9F6C447900410BF64409E5C41A11C76968DADAFA|ylxS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTCCTCCTTGTGC, downstream forward: _UP4_TAATGAATACAAATGTTTTA
  • References

  • 11948165,8491709,20525796,19150615,11493012,27120414