SubtiBank SubtiBank
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website


GTP-binding protein, ribosome-splitting factor, rescues translationally arrested ribosomes
37.51 kDa
protein length
420 aa Sequence Blast
gene length
1263 bp Sequence Blast
rescuing of translationally arrested ribosomes
GTP-binding protein, ribosome-splitting factor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.3|Targets of (p)ppGpp]
  • [category|SW 6|Groups of genes] → [category|SW 6.3|GTP-binding proteins]
  • Gene

    1,875,304 1,876,566

    The protein

    Catalyzed reaction/ biological activity

  • binds and hydrolyzes GTP and readily exchanges GDP for GTP
  • rescuing of translationally arrested ribosomes [Pubmed|26458047]
  • Protein family

  • TRAFAC class OBG-HflX-like GTPase superfamily (with [protein|84E7D672DB40B114DC4D96A4D8834958B47401A7|Obg] and [protein|C0F5FAD6DF89DA9E0FFC8F888D7CED6AA42D9C73|YyaF], according to UniProt)
  • Paralogous protein(s)

  • [protein|B2270316642C66BC2DA86EBDCD1BF6A33CC6A1DC|YphC], [protein|C0F5FAD6DF89DA9E0FFC8F888D7CED6AA42D9C73|YyaF], [protein|CB68B3393CA7862C45C624AF7B1ADD188243A01F|Era], [protein|DF1A043F3D9817D9479B8C707F4ACEEF2BF2862C|YsxC], [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|RbgA], [protein|66A6EC4F6CB91EE741BB9D7646913FF3EE602BD7|ThdF], [protein|84E7D672DB40B114DC4D96A4D8834958B47401A7|Obg], [protein|959C0ED7B9DA50F0EADCF1565405B878D36DA206|YqeH]
  • [SW|Domains]

  • Hflx-type G domain (aa 201-363) (according to UniProt)
  • Effectors of protein activity

  • binds ppGpp [Pubmed|26951678], ppGpp may inhibit activity [Pubmed|26951678]
  • Structure

  • [PDB|5ADY] (the protein from ''E. coli'' in complex with the [SW|ribosome], 41% identity) [Pubmed|26458047]
  • Expression and Regulation




  • the mRNA is processed between [gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR] and [gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-A020 (ynbA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE17430 ([gene|9F6B78C1932FB56F7F71430DB16BC862A312407B|ynbA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGGATGTTCCTTTCTT, downstream forward: _UP4_ATGTAGGAAGGAAATATAAA
  • BKK17430 ([gene|9F6B78C1932FB56F7F71430DB16BC862A312407B|ynbA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGGATGTTCCTTTCTT, downstream forward: _UP4_ATGTAGGAAGGAAATATAAA
  • labs

  • [SW|Naotake Ogasawara], Nara, Japan
  • References


  • 21885683
  • Original publications

  • 12427945,26458047,26951678,26951678