SubtiBank SubtiBank
yoqT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yoqT

unknown
locus
BSU_20520
pI
8.13
mw
5.95 kDa
protein length
gene length
150 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,193,827 2,193,976

    Biological materials

    Mutant

  • BKE20520 ([gene|9F359F7AF38952E8069C5F6AA86061D3ECF3910C|yoqT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATTTCACCTCCGAGA, downstream forward: _UP4_TAATACTTTATGATCGTTAT
  • BKK20520 ([gene|9F359F7AF38952E8069C5F6AA86061D3ECF3910C|yoqT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATTTCACCTCCGAGA, downstream forward: _UP4_TAATACTTTATGATCGTTAT