SubtiBank SubtiBank
spoIIR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

spoIIR

required for processing and compartmentalization of pro-[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]
locus
BSU_36970
pI
4.74
mw
25.20 kDa
protein length
224 aa Sequence Blast
gene length
675 bp Sequence Blast
function
control of [protein|search|SigE ]activation
product
morphological chekcpoint for [protein|search|SigE ]processing
essential
no
synonyms
ipc-27d,csfX

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    3,794,676 3,795,350

    The protein

    Catalyzed reaction/ biological activity

  • interacts with and activates the pro-[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE] protease [protein|221829E084DA78ACE1C2DFCEB6E59EDA534FF55D|SpoIIGA] in the intermembrane space between the forespore and the mother cell [Pubmed|22111992]
  • Modification

  • likely acylated on Thr-27 [Pubmed|22111992]
  • [SW|Localization]

  • localizes initially to the forespore septal membrane (in a [protein|221829E084DA78ACE1C2DFCEB6E59EDA534FF55D|SpoIIGA]-dependent manner), is then exported to the intermembrane space between the forespore and the mother cell [Pubmed|22111992]
  • Expression and Regulation

    Operons

    genes
    [gene|9F338225E1286D530EAAAB504DEC8D5AFA06AC8D|spoIIR]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/spoIIR.html DBTBS]) null

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325,15699190]
  • view in new tab

    Biological materials

    Mutant

  • BKE36970 ([gene|9F338225E1286D530EAAAB504DEC8D5AFA06AC8D|spoIIR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGTCCCCACCGTTCCT, downstream forward: _UP4_TAATCATCTGGTCTAAAAAT
  • BKK36970 ([gene|9F338225E1286D530EAAAB504DEC8D5AFA06AC8D|spoIIR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGTCCCCACCGTTCCT, downstream forward: _UP4_TAATCATCTGGTCTAAAAAT
  • References

    Reviews

  • 31350897
  • Original Publications

  • 16497325,7585939,15044948,11849534,19578359