SubtiBank SubtiBank


required for processing and compartmentalization of pro-[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]
25.20 kDa
protein length
224 aa Sequence Blast
gene length
675 bp Sequence Blast
control of [protein|search|SigE ]activation
morphological chekcpoint for [protein|search|SigE ]processing

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    3,794,676 3,795,350

    The protein

    Catalyzed reaction/ biological activity

  • interacts with and activates the pro-[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE] protease [protein|221829E084DA78ACE1C2DFCEB6E59EDA534FF55D|SpoIIGA] in the intermembrane space between the forespore and the mother cell [Pubmed|22111992]
  • Modification

  • likely acylated on Thr-27 [Pubmed|22111992]
  • [SW|Localization]

  • localizes initially to the forespore septal membrane (in a [protein|221829E084DA78ACE1C2DFCEB6E59EDA534FF55D|SpoIIGA]-dependent manner), is then exported to the intermembrane space between the forespore and the mother cell [Pubmed|22111992]
  • Expression and Regulation


    (according to [ DBTBS]) null

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325,15699190]
  • view in new tab

    Biological materials


  • BKE36970 ([gene|9F338225E1286D530EAAAB504DEC8D5AFA06AC8D|spoIIR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGTCCCCACCGTTCCT, downstream forward: _UP4_TAATCATCTGGTCTAAAAAT
  • BKK36970 ([gene|9F338225E1286D530EAAAB504DEC8D5AFA06AC8D|spoIIR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGTCCCCACCGTTCCT, downstream forward: _UP4_TAATCATCTGGTCTAAAAAT
  • References


  • 31350897
  • Original Publications

  • 16497325,7585939,15044948,11849534,19578359