SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional repressor of the [gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]-[gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]-[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]-[gene|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD] and [gene|75DB6231129C28C5D3791BA43A1261CD46A861E8|opuCA]-[gene|83C45215AC86FACB08CF36EB5F9E6B076D7D0F0F|opuCB]-[gene|CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08|opuCC]-[gene|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|opuCD] operons
21.61 kDa
protein length
185 aa Sequence Blast
gene length
558 bp Sequence Blast
regulation of choline uptake
transcription repressor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • Gene

    3,471,266 3,471,823

    The protein

    Catalyzed reaction/ biological activity

  • transcriptional repression of the ''[gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]-[gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]-[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]-[gene|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD]'' and ''[gene|75DB6231129C28C5D3791BA43A1261CD46A861E8|opuCA]-[gene|83C45215AC86FACB08CF36EB5F9E6B076D7D0F0F|opuCB]-[gene|CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08|opuCC]-[gene|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|opuCD]'' operons [Pubmed|23960087]
  • Protein family

  • GbsR family (with [protein|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR] and [protein|4D288C63F68A9A4B39535D849D455B49F4E65050|YvaV], according to UniProt)
  • Paralogous protein(s)

  • [protein|4D288C63F68A9A4B39535D849D455B49F4E65050|YvaV]
  • [SW|Domains]

  • [SW|HTH marR-type domain] (aa 28-79) (according to InterPro)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A458 (yvbF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33840 ([gene|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGCTGATCATCCCTTCA, downstream forward: _UP4_AAATAAGAGAGCTGCTTTTT
  • BKK33840 ([gene|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGCTGATCATCCCTTCA, downstream forward: _UP4_AAATAAGAGAGCTGCTTTTT
  • References

  • 23960087