SubtiBank SubtiBank
opcR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

opcR

transcriptional repressor of the [gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]-[gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]-[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]-[gene|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD] and [gene|75DB6231129C28C5D3791BA43A1261CD46A861E8|opuCA]-[gene|83C45215AC86FACB08CF36EB5F9E6B076D7D0F0F|opuCB]-[gene|CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08|opuCC]-[gene|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|opuCD] operons
locus
BSU33840
pI
5.84
mw
21.61 kDa
protein length
185 aa Sequence Blast
gene length
558 bp Sequence Blast
function
regulation of choline uptake
product
transcription repressor
essential
no
synonyms
yvbF

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • Gene

    Coordinates
    3,471,266 3,471,823

    The protein

    Catalyzed reaction/ biological activity

  • transcriptional repression of the ''[gene|3F502A4DCB1DAD7C3F968465B13C35213240515B|opuBA]-[gene|70B45E7428DB1F6AEF7D2FE3062CC86BE96674FC|opuBB]-[gene|C48798FE13B1521236F5BC5786B9A02D7BC9A336|opuBC]-[gene|1532EC3D741C5AB3D0B642741218FAE00AD460FA|opuBD]'' and ''[gene|75DB6231129C28C5D3791BA43A1261CD46A861E8|opuCA]-[gene|83C45215AC86FACB08CF36EB5F9E6B076D7D0F0F|opuCB]-[gene|CBA6108A10AD8B932BC5B19A0E7982D0F56F1E08|opuCC]-[gene|76C8D6BF2CA1FA5E7392C52FFD55FD01EF5AB9DC|opuCD]'' operons [Pubmed|23960087]
  • Protein family

  • GbsR family (with [protein|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR] and [protein|4D288C63F68A9A4B39535D849D455B49F4E65050|YvaV], according to UniProt)
  • Paralogous protein(s)

  • [protein|4D288C63F68A9A4B39535D849D455B49F4E65050|YvaV]
  • Expression and Regulation

    Operons

    genes
    [gene|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A458 (yvbF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/458 NBRP B. subtilis, Japan]
  • BKE33840 ([gene|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGCTGATCATCCCTTCA, downstream forward: _UP4_AAATAAGAGAGCTGCTTTTT
  • BKK33840 ([gene|9F32E96AC9C32832C2F10FB125DDDC50EC9B546B|opcR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGCTGATCATCCCTTCA, downstream forward: _UP4_AAATAAGAGAGCTGCTTTTT
  • References

  • 23960087