SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


general stress protein, transcriptional activator ([SW|MerR family]) of the [gene|ADBC0F194B601F736492E54011E0A68351B5BD39|bmr]-[gene|search|bmrR ]operon
32.43 kDa
protein length
278 aa Sequence Blast
gene length
837 bp Sequence Blast
regulation of multidrug resistance
transcriptional activator ([SW|MerR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • Gene

    2,495,898 2,496,734

    The protein

    Protein family

  • [SW|MerR family]
  • [SW|Domains]

  • [SW|HTH merR-type domain] (aa 5-75) (according to UniProt)
  • Structure

  • [PDB|2BOW] (complex with effector), [PDB|1R8E] (complex with DNA), [PDB|1BOW]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10200972], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|9F2C1C9A9DB7AA4CBE72D7C94932B69C8EF0565C|BmrR]: activation, [Pubmed|7961792], in [regulon|9F2C1C9A9DB7AA4CBE72D7C94932B69C8EF0565C|BmrR regulon]
  • [protein|A7326377132C670B60695EFE0A652B1E4F623698|Mta]: activation, [Pubmed|10200972], in [regulon|A7326377132C670B60695EFE0A652B1E4F623698|Mta regulon]
  • regulation

  • ''[protein|search|bmrU]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab


    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • ''[protein|search|bmrU]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials


  • BKE24020 ([gene|9F2C1C9A9DB7AA4CBE72D7C94932B69C8EF0565C|bmrR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCATCACTCCTTCTAT, downstream forward: _UP4_TAATAAAGCATAGAAAAAGA
  • BKK24020 ([gene|9F2C1C9A9DB7AA4CBE72D7C94932B69C8EF0565C|bmrR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCATCACTCCTTCTAT, downstream forward: _UP4_TAATAAAGCATAGAAAAAGA
  • labs

  • [SW|Richard Brennan], Houston, Texas, USA [ Homepage]
  • References

  • 7608059,10220166,11544224,7961792,10200972,20230832,21690368