SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


2-oxoisovalerate dehydrogenase (E1 alpha subunit)
36.18 kDa
protein length
330 aa Sequence Blast
gene length
993 bp Sequence Blast
utilization of branched-chain keto acids
2-oxoisovalerate dehydrogenase (E1 alpha subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of branched-chain amino acids]
  • Gene

    2,499,090 2,500,082

    The protein

    Catalyzed reaction/ biological activity

  • 3-methyl-2-oxobutanoate + [dihydrolipoyllysine-residue (2-methylpropanoyl)transferase]-(R)-N6-lipoyl-L-lysine + H+ --> [dihydrolipoyllysine-residue (2-methylpropanoyl)transferase]-(R)-N6-(S8-2-methylpropanoyldihydrolipoyl)-L-lysine + CO2 (according to UniProt)
  • Protein family

  • BCKDHA family (single member, according to UniProt)
  • Paralogous protein(s)

  • [protein|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|AcoA], [protein|953DE0F0B81894ECFF4C0693511AC238BF3D0C0A|PdhA]
  • Structure

  • [PDB|1UMB] (from '' Thermus thermophilus'', 42% identity, 57% similarity) [Pubmed|15033367]
  • [SW|Localization]

  • Membrane-proximal (Spotty) [Pubmed|16479537]
  • Expression and Regulation



    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|10094682], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|4CEBD81F485DD0B660E297FFC34A0F5270652184|BkdR]: activation, [Pubmed|10094682], in [regulon|4CEBD81F485DD0B660E297FFC34A0F5270652184|BkdR regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|10094682], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • induced in the presence of isoleucine or valine ([protein|search|BkdR]) [Pubmed|10094682]
  • view in new tab

    Biological materials


  • BKE24050 ([gene|9F298088C0A9EB7FE140C935AFC9243C6D4DE8AE|bkdAA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAAGCCCCTCCTTTAT, downstream forward: _UP4_TATGCGAAGTAGGGAGGAAG
  • BKK24050 ([gene|9F298088C0A9EB7FE140C935AFC9243C6D4DE8AE|bkdAA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAAGCCCCTCCTTTAT, downstream forward: _UP4_TATGCGAAGTAGGGAGGAAG
  • References

  • 12427936,15241682,10094682,12823818,16479537,1886522