SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to transcriptional regulator ([SW|LysR family])
31.26 kDa
protein length
292 aa Sequence Blast
gene length
879 bp Sequence Blast
transcriptional regulator ([SW|LysR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • Gene

    4,180,564 4,181,442

    The protein

    Protein family

  • [SW|LysR family] (according to UniProt)
  • [SW|Domains]

  • [SW|HTH lysR-type domain] (aa 1-58) (according to UniProt)
  • Structure

  • [PDB|4X6G] (OxyR from Pseudomonas aeruginosa, 28% identity) [pubmed|25931525]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B849 (yybE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE40670 ([gene|9EC2800AF5B2B65BE3DEB4ABCCE7E448A24440DF|yybE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTATCATCTCTCCTTAT, downstream forward: _UP4_TTTTCTGAGTAGGAAGGATT
  • BKK40670 ([gene|9EC2800AF5B2B65BE3DEB4ABCCE7E448A24440DF|yybE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTATCATCTCTCCTTAT, downstream forward: _UP4_TTTTCTGAGTAGGAAGGATT
  • References

    Research papers

  • 25931525