SubtiBank SubtiBank
dppA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

dppA

D-alanyl-aminopeptidase
locus
BSU_12920
pI
5.19
mw
30.09 kDa
protein length
274 aa Sequence Blast
gene length
825 bp Sequence Blast
function
degradation of cell wall peptides
product
D-alanyl-aminopeptidase
essential
no
synonyms
dciAA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.4|Utilization of peptides]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    1,360,401 1,361,225

    The protein

    Protein family

  • peptidase M55 family (single member, according to UniProt)
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • Structure

  • [PDB|1HI9]
  • Expression and Regulation

    Operons

    genes
    [gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]-[gene|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]-[gene|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD]-[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]
    description
    [Pubmed|1766371]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1766371], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|7783641], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed by glucose (2.9-fold) [Pubmed|12850135]
  • view in new tab

    genes
    [gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]-[gene|062AE5FB4C778178A7F6833CB8BD9D631E461E89|dppB]-[gene|EDF8D2C49FA5552B24135E12524F9035E1E01473|dppC]-[gene|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD]-[gene|853C570CFB9382449A20BE77B44B4FE44972AA59|dppE]-[gene|C4F85F85F0C99A59145961E34B19D3AD03D2BC22|ykfA]-[gene|77EFC47449D8CC17651ED61C41AC605FCEF01270|ykfB]-[gene|D40ECAE51D9E4791C6FAAA25E2E0D0591D9FAA55|ykfC]-[gene|BB94F5388A0D1FF025E5A88A7E10AE7E4C489E5F|ykfD]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE12920 ([gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGCTCCTCCTTTTTT, downstream forward: _UP4_TTCTGCTAAAGGGGTGTTTT
  • BKK12920 ([gene|9E922F0006DF9E84A8D5B51E9FC35B669872FF90|dppA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACGCTCCTCCTTTTTT, downstream forward: _UP4_TTCTGCTAAAGGGGTGTTTT
  • References

  • 18083814,12618455,1766371,19602397,7783641,1766371,12850135,16493705