SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


two-component sensor kinase
50.49 kDa
protein length
454 aa Sequence Blast
gene length
1365 bp Sequence Blast
two-component sensor kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    1,392,643 1,394,007

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|6A37531896205A9B894C81AB0563C216C0B52CD7|YkoG]
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • Paralogous protein(s)

  • [protein|1582E81F7DA85F38D6732D341ABD0F052587F25A|KinE], [protein|4EE48E4931F662E51586DB6D01E91C688329222D|CssS], [protein|52BB660B0CAB36C74F1D47963235846B45AF78AB|YclK], [protein|96E4470EF4B558F4EC318FEBF58B779BA50DB7E2|YvrG]
  • [SW|Domains]

  • two transmembrane segments
  • [SW|HAMP domain] (aa 176-230) (according to UniProt)
  • [SW|Histidine kinase domain] (aa 238-450) (according to UniProt)
  • Modification

  • autophosphorylation on a His residue
  • Structure

  • [PDB|5C93] (Lactobacillus plantarum [protein|E88978809272FAC2520DB4ABCA0554F8028F3451|WalK], corresponds to aa 230 ... 441, 32% identity) [pubmed|28994408]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B312 (ykoH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13260 ([gene|9E8A6AB3920BFBFDAAD1F2E4F333A32354ABB25B|ykoH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCTTGGTCTTCAGCTTCA, downstream forward: _UP4_AGCGAACAGAATGGGGGAGG
  • BKK13260 ([gene|9E8A6AB3920BFBFDAAD1F2E4F333A32354ABB25B|ykoH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCTTGGTCTTCAGCTTCA, downstream forward: _UP4_AGCGAACAGAATGGGGGAGG
  • References

  • 10094672,28994408